kakskdkdid
kakskdkdid kakskdkdid
  • 13-05-2015
  • Geography
Answered

Giving examples, explain how strong acids and weak acids differ ?

Answer :

gesc693 gesc693
  • 13-05-2015
a strong acid is a number between 0-6 on the pH scale and Bases are between 8-14 on the pH scale the difference is how much hydroxide each one has like coca-cola (acid) and backing soda (base)
Answer Link

Other Questions

A host cell is not immediately taken over during which of these A prophage infection B lytic infection C lysogeneic infection D none of the above
Which group in Chinese society is not given equal education and job opportunity 1 the wealthy 2 women 3 men 4 Buddhists
What is a equivalent fraction for 2430
what percent of 50 is 18
Which event in Greek history beginning 323 bc occurred last A Alexander the Great conquers the Persian Empire B The Hellenistic Age C Thebes defeats Sparta and
When Doodle is five what does the narrator decide to teach Doodle and why
After the British took control of Florida in 1763 they decided to move into Georgia In 1778 they captured which historical city A Augusta B Atlanta C Columbus D
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Find the mean of this set of numbers 9 6 8 11 4 10 A 12 B 8 C 2 D 48
Charles Darwin did poorly in school as a young boy How did his poor performance belie his genius