awesomeness2
awesomeness2 awesomeness2
  • 27-04-2015
  • Mathematics
Answered

What is the prime factorization of 1,008

Answer :

Pause
Pause Pause
  • 27-04-2015
The Prime Factors are:
2 x 2 x 2 x 2 x 3 x 3 x 7

In Exponential Form:
2(4 squared) x 3
² x 7(1 squared)

I messed up first time
Answer Link
Аноним Аноним
  • 27-04-2015
The prime factorization of 1,008 is 2³• 3² • 7. [tex] \\ 2*2*2*3*3*7 \\ [/tex]
Answer Link

Other Questions

There are 3 boxes of tangerines Each box has 93 tangerines The tangerines will be divided equally among 9 classrooms How many tangerines will each classroom get
Which of the following products would be possible in the reaction of 2 moles of aluminum Al with 6 moles of hydrochloric acid HCl A 2 moles of AlCl2 and 1 mole
43 Which temperature change indicates an increase in the average kinetic energy of the molecules in a sample1 15C to 298 K 3 305 K to 0C 2 37C to 273 K 4 355 K
Which group colonized most of the Caribbean Central America and South America
How many racial groups existed in Latin american during the 18th century
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how many times does 4 go into 236
A series of legislative acts passed under the Grant administration in 1870 and 1871 authorized federal protection for black suffrage through the use of the Army
what is 336 rounded to the nearest hundreth
In what ways did Mexicos preColumbian Indian heritage shape its culture today