meryglucose meryglucose
  • 16-04-2014
  • Chemistry
Answered

Why do metals bend?
And
What elements as a in stainless steel?
And how (%) of each element

Just answer one question if u want

Answer :

maqsakhan11 maqsakhan11
  • 16-04-2014
It is the electrons moving between the metal atoms but its more to do with how metals are structured. Basically you can think of it as layers of atoms with free electrons moving around. Metals can be molded because these layers can slide around each other, so the entire metal can be made into a different shape.

This is why metals bend.

Answer Link
szei16brown2001 szei16brown2001
  • 16-04-2014

Because medal can get weak when used to much!!!
Answer Link

Other Questions

Name two decimals that are equivalent to 77
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Solve the given system of linear equations for y 4x y 11 and x 2y 8
What led to the establishment of Providence the first permanent settlement in Rhode Island
I need a sentence with the word Fate in it
Write each rational numbe as a fraction
jan needed to empty 18 gallons of water from a tub into jugs that hold 05 gallons of water How many jugs did jan need
Find the slope of the line 2x10y20
Back in the early 1620s the pilgrims celebrated a Day of Humiliation What did they do on that day a Prayed and fasted b Confessed to the group a lie they had to
The colonies that became the original United States were part of which European nations land claims