Qouia1234 Qouia1234
  • 02-03-2015
  • Mathematics
Answered

15 is 10% of what number

Answer :

MathG33k
MathG33k MathG33k
  • 02-03-2015
15 is just 10% of a number. 10% is 1/10 of a hundred percent, so to find the 100%, multiply  15 by 10 and get: 150
Answer Link
Slappy
Slappy Slappy
  • 02-03-2015
150. It is 150 because you take 150 divided by 100 equal 1.5 and then you times it by ten and it is 15.
Answer Link

Other Questions

Find the probability of this event if one of these cards is drawn at random Not selecting an S S U M M ER
what are advantages and disadvantages of breakwater
Why were some Americans opposed to the Tennessee Valley Authority
Aaron is at a spot in his book where the page numbers of the two facing pages have a product of 1980 what are the two page numbers
how many school text book that i can buy with 5 billion this is my civics homework
Algebra 1 i just need help with understanding multiple step equations like72414d36 D
How does gene therapy affect a cell A Cells with defective genes are replaced with cells of normal genes B Cells with normal genes are replaced with cells of de
Congress impacts the federal budget through the A Congressional Budget Office B The House Appropriations Committee C The Senate Appropriations Committee D All o
How to find the area of a circle
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5